Ruthenium polypyridyl complex bound to a unimolecular chair-form G-quadruplex

McQuaid, K. T. ORCID: https://orcid.org/0000-0002-3222-5584, Takahashi, S., Baumgaertner, L., Cardin, D. J., Paterson, N. G., Hall, J. P. ORCID: https://orcid.org/0000-0003-3716-4378, Sugimoto, N. and Cardin, C. J. ORCID: https://orcid.org/0000-0002-2556-9995 (2022) Ruthenium polypyridyl complex bound to a unimolecular chair-form G-quadruplex. Journal of the American Chemical Society, 144 (13). pp. 5956-5964. ISSN 0002-7863 doi: 10.1021/jacs.2c00178

Abstract/Summary

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, con-sistent with its transient formation in live cells. The stabilisation of a particular topology by a small molecule is of great importance for therapeutic applications. Here we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays en-antiospecific G-quadruplex binding. It crystallised in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterised example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a compar-ative ligand binding study, we showed, using a Klenow fragment assay, that the title complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Item Type	Article
URI	https://reading-clone.eprints-hosting.org/id/eprint/103951
Item Type	Article
Refereed	Yes
Divisions	Life Sciences > School of Chemistry, Food and Pharmacy > Department of Chemistry Interdisciplinary centres and themes > Chemical Analysis Facility (CAF) > Xray (CAF) Life Sciences > School of Chemistry, Food and Pharmacy > School of Pharmacy > Medicinal Chemistry Research Group
Publisher	American Chemical Society
Download/View statistics	View download statistics for this item